|
|
|
|
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 10:07:02 AM |
ID is testable, makes predictions and is falsifiable and therefore has the required characteristics to qualify it for the scientific model.
What testable hypothesis has ID brought forward that hasn't been disproved yet?
Spontaneously appearing by magic (or seeded by aliens, or on crystals, or by lightening on mud puddles) still qualifies naturalistic evolution, so why does it disqualify ID?
It's clear you do not understand Theory of Evolution, The Theory of Evolution is not an explanation of the origin of life, it is an explanation of the complexity and diversity of life through well observed and predicted processes. Evolution is neither random nor spontaneous. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 10:13:35 AM | E.Kyro
ID is testable, makes predictions and is falsifiable and therefore has the required characteristics to qualify it for the scientific model.
Quoted for hilarity.
Any chance of you backing this statement up? | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 11:16:43 AM |
You call it absurd but don't back it up with any reasoning and ignore clear cut cases where it did happen.
Clear cut case of discrimnation? I have one of those for you.
Last week I went for a job at my local church, I wanted to become a minister. Sadlly though I never got the job because I do not belive in god or the bible! That is just as much a clear cut case of discrimination!
"Help, i'm being discriminated against! Come see the violence inherent in the system."
 | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 11:21:56 AM | Posted by JVHM
It's clear you do not understand Theory of Evolution, The Theory of Evolution is not an explanation of the origin of life, it is an explanation of the complexity and diversity of life through well observed and predicted processes. Evolution is neither random nor spontaneous.
New genetic information had better be spontaneous or the foundation for evolutionary theory through naturalistic causes, crumbles to dust.
Whether you want to sweep it under the carpet or not, evolution still requires an abiogenises event.
Any chance of you backing this statement up?
Yes. Intelligent design theory predicts: 1) that we will find specified complexity in biology. One easily detectable form of specified complexity is irreducible complexity. We can test design by trying to reverse engineer biological structures to determine if there is an "irreducible core." Intelligent design also makes other predictions, like (2) rapid appearance of complexity in the fossil record, (3) re-usage of similar parts in different organisms, and (4) function for biological structures. Each of these predictions may be tested--and has been confirmed through testing!
Last week I went for a job at my local church, I wanted to become a minister. Sadlly though I never got the job because I do not belive in god or the bible! That is just as much a clear cut case of discrimination!
You being entirely honest or is the real reason that you haven't had theological training other then here at POF? I don't think belief in a god is a prerequisite for a job as a minister, but proper schooling is. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 11:52:56 AM | | Irreducable complexity is about arguing that an organism could not exist at a lower level of complexity than presently observed, therefore it must have had some help to get to this stage. I haven't read of any examples of this so called hypothesis that have been proved, if indeed it is provable. The folks who make this argument have a vested interest in doing so. Their conclusions do not follow naturally from observation of nature but are argued from a view of incredulity in the face of something they cannot and don't particularly want to explain. They really ought to leave these questions to real scientists. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 11:59:46 AM |
Irreducable complexity is about arguing that an organism could not exist at a lower level of complexity than presently observed, therefore it must have had some help to get to this stage. I haven't read of any examples of this so called hypothesis that have been proved, if indeed it is provable. The folks who make this argument have a vested interest in doing so. Their conclusions do not follow naturally from observation of nature but are argued from a view of incredulity in the face of something they cannot and don't particularly want to explain. They really ought to leave these questions to real scientists.
This is precisely the issue...incredulity.
This is also why the makers of "Expelled" didn't want people like Kenneth Miller anywhere near their film; firstly because they are Christians and secondly because they are educated bio-scientists who have demolished all of the supposed arguments of I.D. on numerous occasions and in great detail including the specious irreducible complexity argument. Miller doues a particularly good job on the flaggellum example that is often trotted out. I.D. is "clearly" a religious argument - not a scientific theory. This has twice been decided in a court of law now after extensive deliberation.
As far as attempting to continually re-assert that it is somehow a science or theory, as the old expression goes, "That dog won't hunt." | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 12:19:24 PM |
(2)rapid appearance of complexity in the fossil record,
Rapid appearance of complexity in the fossil record would be something like the oft used quote about the appearance of a rabbit fossil in the pre- cambrian. Something that would disprove the fossil record's evidence of gradual accumulated change. It has never been demonstrated as far as I know. Examples?
3) re-usage of similar parts in different organisms,
Not sure where you're going with this one. There are relationships between the parts that appear in different organisms but they are consistent with evolutionary theory as far as I know. If, because of a lack of suitable bits available in the workshop one day, the proposed designer had decided to unleash his creative flair and plonk a pair of insect style compound eyes on a mammal, it might prove your point. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 12:22:14 PM |
Were not all those things brought about by intelligent designers? Do Archaeologists dig and study sites where there is no sign of intelligently designed artifacts? Of course not. When they study these sites they use the intelligently designed artifacts to determine the level of intelligence, technological advancement, degree of civilization, type of thinking, language, etc. to get an idea of the intelligence that created the artifacts.
SETI attempts to find extraterrestrial clues in an attempt to find evidence for intelligent life. The clues they look for are things which show signs of having been intelligently designed, ie radio waves with patterns broadcasting on a narrow beam indicating a purpose built transmitter, etc.
Ok, forget it.
I suspected that you don't comprehend the true definition of Intelligent Design. And you've proven me correct in my assumption. And one cannot debate with someone who doesn't fully understand what it is they're debating.
Archaeological digs/artifacts (ie: finding a water jug) are not "intelligently designed" by definition of ID. They were designed and handcrafted by actual living breathing human beings, not by some deity. Wow.... I'm baffled on your thought process there, sorry.
And again, looking for physical living alien life forms by way of human made radio wave transmittors (ie: the Allen Telescope Array) and trying to find little green men who are also sending off radio signals to us..... how does that relate to intelligent design research ?
Intelligent Design research would be attempting to proove that the origins of life were by way of this deity/creator guy. Looking at everything around us and touching it, smelling it, etc does not proove ID.
Finding little green men does not proove the ID theory, it will just proove that little green men exist. Finding a water jug buried in the sand does not proove ID theory, it just prooves that there was this human being who lived 'x' number of years ago and combined water with clay to make a pretty little jug.
The greater the degree of complexity of the artifact in question, the greater the likelihood that it is the result of an intelligent designer especially if the object in question has an easily recognizable purpose like pottery, hieroglyphics or a Klingon soundtrack from star system 9X.
What ??!! No it does not ! Complexity of something (pottery ?) does NOT proove anything, nor does the purpose of something. The engine in your car is a complex mechanical arrangement of metal pieces used for the purpose of getting from point 'a' to point 'b' in a short span of time.... Are you telling me that some deity made that engine and not the car manufacturer ?
Wow, this tells me just how deeply seeded you are in with this stuff. You familialy relate absolutely everything to magical design and give no credit whatsoever to the human capability. So in essence, going from that theory, if your children end up to be successful in life, you as a parent deserve absolutely no credit for raising them right because you didn't. God, specifically god, taught them the importance of an education, not you.... thus you're just a useless piece of meat and weren't even necessary to have around. So why be a parent ? Why be/do anything at all ? God is creating, doing, and handling absolutely everything, right ?
Are you even hearing yourself ?
Wow..... holy crap, wow. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 12:48:10 PM |
Here's the latest reviews on the movie :
"Stein's schlumpy presence is disarming, though his know-it-all nature is at odds with his free-speech posing." ~ Joe Neumaier, New York Daily News
"Expelled may prove to be as controversial as the producers hope, but the reactions will be more entertaining and elucidating than the film itself. " ~ John P. McCarthy, Boxoffice Magazine
"The movie itself is an example of design by faith and emotion rather than intelligence, defined as rationality grounded in proof." ~ Nell Minow, Chicago Sun-Times
"The film shows that Intelligent Design should be on the table for discussion. But if you're looking for ammo to argue your Darwinist friends under the table, look elsewhere. " ~ Mark Moring, Christianity Today
"Stein claims to denounce the tyranny of dogma, then browbeats us with his own." ~ Rafer Guzman, Newsday
"Surely the film's greatest offense is the utter shamelessness with which it exploits the Holocaust." ~ Ken Fox, TV Guide's Movie Guide
"Stein spends the first half of the movie setting himself a trap, and the second half squirming in it." ~ Kyle Smith, New York Post
"This is propaganda, a political rant disguised as a serious commentary on stifled freedom of inquiry." ~ Claudia Puig, USA Today
"The man made famous by Ferris Bueller, however, quickly wades into waters far too deep for him." ~ Jeffrey Kluger, TIME Magazine
Interesting indeed.....
| |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 1:21:44 PM |
New genetic information had better be spontaneous or the foundation for evolutionary theory through naturalistic causes, crumbles to dust.
New genetic information is explained by mutation, again that is not spontaneous, there are reasons for it happening that we understand.
Whether you want to sweep it under the carpet or not, evolution still requires an abiogenises event.
Yes but we don't need to understand the abiogenisis event in order for evolution to explain the complexity and diversity of the life we see around us.
1) that we will find specified complexity in biology. One easily detectable form of specified complexity is irreducible complexity. We can test design by trying to reverse engineer biological structures to determine if there is an "irreducible core."
There has not been one single case of something being brought forward as being irreducibly complex, everything from the eye to the flagellum has been shown to have less complex instances in nature where they didn't have all the parts but still served a valuable function that was beneficial to the survival of the species.
Clarence addressed the other two points adequately so I am not going to bother. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 4:11:21 PM |
Posted by Clutterbuck
. Their conclusions do not follow naturally from observation of nature but are argued from a view of incredulity in the face of something they cannot and don't particularly want to explain. They really ought to leave these questions to real scientists.
Interesting you should say that. Here is what a couple of Darwinists have to say about it:
Darwin wrote, "If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down."
Richard Dawkins writes, “Biology is the study of complicated things that give the appearance of having been designed for a purpose.”
That’s also why Francis Crick writes, “Biologists must constantly keep in mind that what they see was not designed, but rather evolved.
So in actual fact, "real" scientists naturally see purposely designed and then have to force it into naturalistic evolution.
I haven't read of any examples of this so called hypothesis that have been proved, if indeed it is provable.
The onus is actually on evolutionists to prove that these examples could have come about through natural means which contrary to some posters opinions hasn't even come close.
It’s therefore not surprising that the scientific literature shows a
complete absence of detailed, testable, step-by-step proposals for how
coevolution and co-option could actually produce irreducibly complex
biochemical systems. In place of such proposals, Darwinists simply
observe that because subsystems of irreducibly complex systems might be
functional, any such functions could be selected by natural selection. And
from this unexceptional observation, Darwinists blithely conclude that
selection works on those parts and thereby forms irreducibly complex
systems.22 But this conclusion is completely unfounded, and accounts for
cell biologist Franklin Harold’s frank admission that “there are presently
no detailed Darwinian accounts of the evolution of any biochemical or
cellular system, only a variety of wishful speculations.”23 Biologist Lynn
Margulis is equally forthright: “Like a sugary snack that temporarily
satisfies our appetite but deprives us of more nutritious foods, neo-
Darwinism sates intellectual curiosity with abstractions bereft of actual
details—whether metabolic, biochemical, ecological, or of natural history."
Irreducible Complexity Revisited
William A. Dembski
version 2.0, revised 2.23.04
Posted by Clutterbuck
Rapid appearance of complexity in the fossil record would be something like the oft used quote about the appearance of a rabbit fossil in the pre- cambrian. Something that would disprove the fossil record's evidence of gradual accumulated change. It has never been demonstrated as far as I know. Examples?
Cambrian Explosion, Punctuated Equilibrium, Hopeful Monsters, etc.
Posted by AncientMuse
I suspected that you don't comprehend the true definition of Intelligent Design. And you've proven me correct in my assumption. And one cannot debate with someone who doesn't fully understand what it is they're debating.
You aren't the first to accuse me of not understanding or comprehending and you likely won't be the last. 
Archaeological digs/artifacts (ie: finding a water jug) are not "intelligently designed" by definition of ID. They were designed and handcrafted by actual living breathing human beings, not by some deity. Wow.... I'm baffled on your thought process there, sorry.
Living, breathing, human beings are intelligent designers in comparison to a dog, cat or a rock. Just as God or green men from alpha centauri are potentially better intelligent designers then humans. My point was to draw a parallel between archaeology, SETI and Intelligent Design sciences.
Posted by JVHM
New genetic information is explained by mutation, again that is not spontaneous, there are reasons for it happening that we understand.
Mutations change existing genetic information but how does it introduce new information? Can I modify or mutate a steel bar into a Porsche without introducing new materials into the mix?
Yes but we don't need to understand the abiogenisis event in order for evolution to explain the complexity and diversity of the life we see around us.
If you don't understand it, then you can't make predictions and therefore falls outside of the qualifications required for it to be a science.
There has not been one single case of something being brought forward as being irreducibly complex, everything from the eye to the flagellum has been shown to have less complex instances in nature where they didn't have all the parts but still served a valuable function that was beneficial to the survival of the species.
Only about 10 of the 40 components can be explained by co-option, but the other 30 are brand new. Also, the very process of assembly in the right sequence requires other regulatory machines, so is in itself irreducibly complex. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 5:46:31 PM |
Mutations change existing genetic information but how does it introduce new information?
Mutations change existing information into new information. Different combination of existing DNA yeild different results.
Can I modify or mutate a steel bar into a Porsche without introducing new materials into the mix?
Bad anology, you seem to think in order for a mutation to occur that the DNA has to introduce a new chemical to the base pair or something. There are 2 base pairs in DNA; Guanine - Cytosine and Adenine - Thymine
Say you have a strand of DNA
ATTAATATTAGCCGGCATTA
And it changes to
ATTAATATATGCCGGCATTA
This tiny change is a mutation that will yeild something totally different that the original, it didn't have to introduce anything new it's just a different combination of how the code is arranged and as a result something new is created.
If you don't understand it, then you can't make predictions and therefore falls outside of the qualifications required for it to be a science.
The Theory of Evolution isn't making predictions on abiogenisis, it's completely irrelevant . If you want to talk abiogenisis, saying we don't understand so "god did it" and not in scope of science to try and discover is a fallacy. We are beginning to uncover possible models for abiogenisis that have supporting evidence from experimentation.
Only about 10 of the 40 components can be explained by co-option, but the other 30 are brand new. Also, the very process of assembly in the right sequence requires other regulatory machines, so is in itself irreducibly complex.
Uh are we talking about the Flagellum? In the study of the e.coli flagellum it was found that of the 40 protein components only 2 were unique to the flagellum all the other ones closely resemble other proteins that have other useful functions in the bacteria. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 5:56:53 PM |
evolution still requires an abiogenises event
Just going back to this, this is untrue. Only Young Earth Creationists require an "event". Evolution requires an abiogenesis process. A process that while outside the scope of evolution itself would probably still have involved a long progression of Darwinian natural selection to get started.
Evolutionists and evolutionary biologists don't "sweep it under the rug" in the same way that mathematicians don't sweep Dark Matter under the rug. It's not a secret. It's just not their field.
The onus is actually on evolutionists to prove that these examples could have come about through natural means which contrary to some posters opinions hasn't even come close.
Well, for a start, it's not. The onus isn't on evolutionists at all. Like it or not when you're a slim percentage of vocal fundamentalist fanatics screaming in the face of overwhelming scientific evidence, the onus is kind of on you. if you weren't so good at annoying school boards we could give you the solid ignoring you deserve.
The ID proponent's shrill exultation that Evolutionists don't have answers to stupid questions doesn't prove Irreducable Complexity. I know nothing about biochem, so I won't propose to answer this question. Though I get the feeling that if I looked up your quotes they would be quite thoroughly out of context. :)
I've never heard of "Hopeful Monsters" so I looked it up. I noticed one interesting line.
His thesis however was universally rejected and widely ridiculed within the biological community
So you're using a brief and widely criticised theory as evidence. Punctuated Equilibrium is in some ways the same general idea, though it's both more advanced and more recognised. I'm not quite sure how it supports your theory, though.
The pre-cambrian explosion certainly doesn't. It fits quite well with evolutionary theory, as wildy different "starter" organisms evolved quickly to fill the many niches of the time. Most didn't work out and died. Regrettably, because some were awesome.
If you don't understand it, then you can't make predictions and therefore falls outside of the qualifications required for it to be a science.
Err.... in relation to evolution wouldn't be a prediction, it would be a.. retrodiction? Something like that. As for study and making predictions, yes, it can be done, has been done, and will be done more.
Experiments were done on "primordial soup" type materials to see if they form complex compounds, such as amino acids. And yes. They do. Good science, a step at a time.
Only about 10 of the 40 components can be explained by co-option, but the other 30 are brand new.
What components? Of what? Need context.
Also, the very process of assembly in the right sequence requires other regulatory machines, so is in itself irreducibly complex.
No it's not. Sorry, but that makes no sense. There's no "right sequence". Evolution, natural selection, is a process. Not a random assembling of organs in the hopes it makes an organism (that doesn't die). The "right sequence" is self-assembling. | |
|
| |
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 8:04:52 PM | E.kyro....
I don't want this this thread to turn around as a personal attack on you. So please don't missunderstand what's going on here.
I respect you as an intelligent fellow human being, and I respect the fact that you possess the bajonkas to voice your thoughts/opinions on the subject matter. Believe me, I do, I truly mean that. Because you seem to be outnumbered here, so kudos to you, and that takes guts.
And I guess I can only speak for myself here when I say : I thoroughly enjoy the debate process with persons of opposite opinions as myself. So Please, don't stop the debate process.
I believe that we as fellow human beings desperately need this to try and iron out the wrinkles in society as a whole, with the hopes that we come to some sort of agreement and/or compromise in order to live with each other. And thankfully we have the wonderful internet to touch other humans in a way that we've never been able to before.
Because let's face it. We have to be able to live amongst one another. The world I'm seeing this past decade scares the hell out of me. We need this fat chewing, we really do.
So please don't take this as a personal attack.... it can get ugly at times, but it's somewhat 'theraputic' for each of us as thinking individuals IMO. And it's obvious that we will never be able to resolve this.... It's my opinion that only science will be able to accomplish this in and of itself. Our generation is unfortunately in the 'ironing' process. So until more questions can be answered by both sides, and I mean TRULY answered.... this quest will continue from both sides of the coin.
Keep the thoughts coming ! I mean that. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 9:06:39 PM | E.Kyro said:
The onus is actually on evolutionists to prove that these examples could have come about through natural means
Biologists have already met this onus. Suppose, for instance, I proposed that my dog jumped onto a very high counter and ate my birthday cake. The evidence I have to support this claim is the dog's paw prints, fur in the remains of the cake, icing on the dog's muzzle, and the animal's subsequent diarrhea from eating human food. Seems pretty clear what happened, no? If someone then remarked, "Yes, but HOW did the dog manage to get onto such a high counter? The onus is on YOU to prove this, otherwise your whole theory goes down the tubes!"
Clearly, such a person who makes such a remark is wrong. The evidence overwhelmingly supports that the dog ate the cake, and lacking an explanation for one little detail doesn't invalidate the whole thing. In fact, the evidence for the scenario as a whole pretty much proves that the dog somehow got the cake off the counter, even if we can't explain this in as much detail as you'd like.
The same is true of evolution. There is a lot that scientists can't currently explain. But what evolution HAS explained already (and it's a lot) supports it to such a degree that pointing to areas of ignorance hardly invalidates the theory. If you'd like, I can explain the evidence for evolution in more detail in another post. Simply ask and I'll be glad to tell you. (I need to save space, for now, to address your other claims, though.)
Mutations change existing genetic information but how does it introduce new information? Can I modify or mutate a steel bar into a Porsche without introducing new materials into the mix?
I think your example is problematic. It is better to think of DNA as an alphabet. For instance, in the English language, there are never any new letters of the alphabet introduced, yet we are capable of producing almost an infinite number of words with only 24 letters! This is because we can arrange and rearrange those letters in various manners. To wonder how we can produce new "information" in biology with only mutations and rearrangements is almost as silly as to ask how we can produce new words with only rearrangements of twenty or so letters and being unable to introduce new letters.
But here's a brief explanation of how it works. Most mutations that occur are neutral, a good proportion are bad, and a few select ones lead to benefits. When DNA copies itself, sometimes mistakes are made. Sometimes one letter is misplaced with another. Sometimes the error involves copying a letter or "phrase" too many times. This explains how organisms can have different arrangements of proteins and greater or lesser numbers of them. Another way to create new "information" is to have separately living organisms essentially unite to form a single organism in a sort of biological synthesis after ages of symbiotic living. The mitochondria in your cells are ancient symbionts of just this sort. They have nothing to do with our ancestor cells producing such complex new information, but arose because they decided to simply live with us in harmony. That's just yet another example of how it can occur.
If you don't understand it, then you can't make predictions and therefore falls outside of the qualifications required for it to be a science.
Abiogenesis doesn't fall outside of the qualifications required to be a science. When the other person said we don't necessarily understand how life first arose, he didn't mean that the various theories of abiogenesis don't make testable predictions, but rather that we don't have enough evidence to support one over another. There are a bunch of competing hypotheses (from theories involving clay crystallization to theories of an "RNA world"), and we are perfectly capable of understanding these hypotheses and their entailments--what we don't yet know is which one is correct. That will require more time and research.
Only about 10 of the 40 components can be explained by co-option, but the other 30 are brand new. Also, the very process of assembly in the right sequence requires other regulatory machines, so is in itself irreducibly complex.
Irreducible complexity is a silly argument. Basically, it is an argument from ignorance. It goes something like this: "Scientists currently can't explain this! Therefore their current theory must be wrong!" This is untrue, however, because there is evidence outside of current areas of ignorance that overwhelmingly supports the theory, even in spite of our lack of perfect knowledge of everything involved. It is also a silly argument because it doesn't even account for the actual process of evolution. It assumes, for instance, that for an eye to have evolved, each irreducible part must have been used for sight. But this isn't how evolution works at all! For instance, biologists know that fish evolved "lungs" from their swim bladders (modern lungfish more than adequately prove this point). Now, someone arguing from irreducible complexity can say, "Ah, but if you remove THIS part of the fish's lung, it no longer functions as a lung!" That's correct, but it can still function as a SWIM BLADDER. And this is why the concept of irreducible complexity fails so miserably in addressing evolutionary claims, because it doesn't even attempt to account for how they actually work, and in doing so appeal not to any evidence for design, but to our current IGNORANCE of any mechanism, which is far from science. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/23/2008 9:46:36 PM | E.Kyro, you said the ID predicts the following:
1) that we will find specified complexity in biology. One easily detectable form of specified complexity is irreducible complexity. We can test design by trying to reverse engineer biological structures to determine if there is an "irreducible core."
The problem with this "prediction" is that it is muddled to its core. Dembski's conception of specified complexity is deeply flawed. He does science like a mathematician who is unconcerned with empirical data, and it shows. All he has done is constructed a mathematical model that arbitrarily specifies certain degrees of "complexity" as evidence of design, and yet he has acknowledged that his model yields false positives. He hasn't shown any evidence of design, or shown any fulfilled predictions with this model. All he has done is create a model that will verify life is designed, but he has yet to show that this model is accurate or true, and the false positives it yields show otherwise.
Furthermore, it is rather obvious that something that is "intelligently designed" need not have any complexity. If I choose to make a painting by randomly throwing a bucket of paint at it (a la certain postmodern artists), this surely wouldn't show any specified complexity, and yet it was designed. Therefore, this isn't a prediction of ID, as we could observe complexity or a total lack of complexity and still attribute it to design.
(2) rapid appearance of complexity in the fossil record
This is also not an adequate prediction of ID. An intelligently designed artifact can be constructed rapidly or slowly. Some people write books in weeks, some take decades. ID does not specifically predict any time period we should expect. Even if the appearance wasn't rapid, you could still say a designer played a part, but he was just taking his sweet time (perhaps resting on the seventh day instead of working).
(3) re-usage of similar parts in different organisms
Again, this is not an adequate prediction. As an intelligent designer myself, I can decide to create one machine out of wood and clay, and another out of metal and rope. I can decide to use similar parts in each, or I can decide to use completely separate parts. Hence, this cannot qualify as a prediction of ID.
function for biological structures
I think you know what I'm going to say: not a specific prediction. Plenty of artifacts have been intelligently designed that serve no function whatsoever. Humans are well known for creating just to create, for instance, not for a means to an end, but as an end in itself.
Each of these predictions may be tested--and has been confirmed through testing!
Not necessarily. For instance, the "predictions" about functionality and similar parts are actually entailed by evolution as well, so naturally these have been confirmed, but unfortunately in favor of evolution. (This is because the function and similarity follows a chronological pathway, matching up not only with an evolutionary timeline, but also with independent lines of evidence in studies of genetic similarity and so on that also match the timeline and evolutionary relationships. See how the interconnections build the theory so much stronger than the disparate grasping at straws you find on the creationist end?)
As for specified complexity, I've already addressed the mathematical errors in this, and in my previous post I've explained that it doesn't really address the process of evolution, because it ignores the fact that functionality can change over time, and is hardly ever static. The function can also "disappear" and the structure can remain for a short while as "white noise" that serves no function...lying in wait for the next great adaptation to change it to something better. (That is the proposed explanation for much of our "junk DNA", for instance--it serves as neutral, unused white space that evolution can use for new changes, even though it is currently functionless.)
The claim about "rapid appearance of complexity" is also not true (insofar as creationists use the term). The common claim is made about the "Cambrian explosion," which was a period spanning millions of years and hardly entails an appearance of complexity of such a degree that evolution cannot explain it. One of the problems is that the creationists may focus on superficial differences rather than real ones. For instance, I once had a creationist claim that there could not be enough time for something that is vaguely rat-like to evolve into a human, even over a million years...but when you disregard the superficial outward differences and look at the genetic differences between a human and a mouse, you see that the similarity is startingly, that we share over 60% of our genes with mice! Under that lens, the change doesn't seem so drastic or hard to accomplish in a million years!
As an aside, I'd like to point out one more thing that illustrates why ID is not "science" proper. Look at your predictions for ID. Obviously, they are not the specific logical entailments of design. You can see just the opposite of these predictions (as I've explained above) and still appeal to a designer. However, most of these "predictions" for ID actually only seem to "work" because they are attempted falsifications of evolution. In other words, they are attempts at testing evolution, not design! The remarks about complexity and their rapid arrival are good examples of this. These aren't predictions of design, but are instead attempts to refute evolution. "Boy, evolution can't explain THIS design, or that design happening so RAPIDLY." This isn't evidence in favor of design, even if true, but instead ham-headed attempts at falsifying evolution (which fail miserably). What this means is that ID is an argument from ignorance. "Evolution can't explain THIS, therefore our side wins!" It doesn't attempt to explain anything itself, but only points out what it thinks evolution can't or hasn't explained. This is hardly the basis of a scientific theory.
At the trial in Dover, for instance, one ID testifier claimed you could "test" ID by putting a bunch of organisms in an environment that would favor the evolution of motility, and then observing whether they evolved motility or not. What a howler! This is an attempt at proving that organisms can evolve. If the organisms don't manage to evolve motility, at best all that shows is that they did not evolve, not that they were necessarily created, or that creation is the only mechanism of change! Of course, the experiment itself is poorly thought out and not a real test of evolution, but it serves as a good example of just how vacuous ID is a as a "theory," and how it relies wholly on ignorance and untestable claims. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/24/2008 4:46:39 AM |
Posted by saintgasoline
The evidence overwhelmingly supports that the dog ate the cake, and lacking an explanation for one little detail doesn't invalidate the whole thing. In fact, the evidence for the scenario as a whole pretty much proves that the dog somehow got the cake off the counter, even if we can't explain this in as much detail as you'd like.
Lacking one detail? If the dog was not capable of jumping out of its own way yesterday but today leaps over counters in a single bound, then it is more then one little detail. The evolutionist says it changed all by itself.....by magic, whereas an ID'er looks for an external agency that brought about the change. The change is the same for either but the motivating force behind it, is where we diverge.
Anyway you have given me some things to look at but I will be busy with RL for the next few days and will not be able to do much research before the weekend. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/24/2008 5:14:20 AM | | I've tried to read the whole thread and understand the points about intelligent design verses evolution. One argument that seems to make me ponder is that Intelligent design can only be proved by producing a god can't it? Is there some other way? Yet with evolution or scientific argument data is constantly being produced, the more we study the more we learn. Now of course we haven't got to the point to completely refute the god theory but we are certainly heading in that direction aren't we? Wouldn't it make sense that intelligent design arguments would be getting more believable given the time and effort put in? | |
|
| Expelled: No Intelligence Allowed
Posted: 4/24/2008 5:48:44 AM | One argument that seems to make me ponder is that Intelligent design can only be proved by producing a god can't it?
In an effort to get back into school creationist changed the term god to designer and made it vague that the designer has to be god, it could be an alien race or something that way a whole bunch of other kooks could latch on to the idea as well.
But yes, ID has not produced one single hypothesis that hasn't been thoroughly debunked, their best on is irreducible complexity, yet every example they produce we are able to find less complex instances of the example and show how the sum of it's parts are functional in one way or another on their own.
Now of course we haven't got to the point to completely refute the god theory but we are certainly heading in that direction aren't we?
We will never completely refute it because there is no falsifiable experiments and no evidence to disprove or prove such a being. The best we can do is say that we are reasonably sure that there is no god.
Wouldn't it make sense that intelligent design arguments would be getting more believable given the time and effort put in?
No, repeating a lie doesn't make it any more true over time. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/24/2008 6:48:01 AM | So it has to be asked why have they renamed their theory? Are they trying to distance themselves from the church? Or is the church at the heart of this? If so what church? How does one go about changing the name of a theory like that? And why?
I know that religion constantly repackages the idea in new and different ways to sell its religion. The practice works obviously. But to change something at the root like this one has to wonder, no? | |
|
| Expelled: No Intelligence Allowed
Posted: 4/24/2008 7:03:57 AM |
So it has to be asked why have they renamed their theory? Are they trying to distance themselves from the church? Or is the church at the heart of this? If so what church? How does one go about changing the name of a theory like that? And why?
They renamed their theory because a couple decades ago the US government denied creationism being taught as an alternative in science classes. So they renamed it to intelligent design and attempted to remove ll references to god and switch it to intelligent designer and creationist to design proponents.
This explains it:
http://www.youtube.com/watch?v=dqNH-Hnsfgg | |
|
| Expelled: No Intelligence Allowed
Posted: 4/24/2008 8:41:01 AM | Lacking one detail? If the dog was not capable of jumping out of its own way yesterday but today leaps over counters in a single bound, then it is more then one little detail. The evolutionist says it changed all by itself.....by magic, whereas an ID'er looks for an external agency that brought about the change. The change is the same for either but the motivating force behind it, is where we diverge.
WTF??? So according to your idiotic theory an olympic athete who does better today than they did a year ago is seen by *evolutionists* as magic?
You don't seem to have grasped it yet, but the people who believe in *magic* & chant spells etc are the clueless superstitious people such as yourself....
As for this movie:
I see Yoko slapped them with a lawsuit yesterday.. | |
|
| Expelled: No Intelligence Allowed
Posted: 4/24/2008 9:13:54 AM |
This explains it:
http://www.youtube.com/watch?v=dqNH-Hnsfgg
Great video and wonderful irony at the end with the hastily made document | |
|
| Expelled: No Intelligence Allowed
Posted: 4/24/2008 9:19:50 AM |
I see Yoko slapped them with a lawsuit yesterday..
John would be spinning in his grave if he thought any of his songs would be used to further the cause of dishonest psuedo science with roots deep in judeo-christian religion | |
|
|
|
Home
login 
