Notice: Forums will be shutdown by June 2019

To focus on better serving our members, we've decided to shut down the POF forums.

While regular posting is now disabled, you can continue to view all threads until the end of June 2019. Event Hosts can still create and promote events while we work on a new and improved event creation service for you.

Thank you!

Plentyoffish dating forums are a place to meet singles and get dating advice or share dating experiences etc. Hopefully you will all have fun meeting singles and try out this online dating thing... Remember that we are the largest free online dating service, so you will never have to pay a dime to meet your soulmate.
     
Show ALL Forums  > Science/philosophy  >      Home login  
 AUTHOR
 coca2
Joined: 4/8/2010
Msg: 1240
Evolution.Page 49 of 64    (24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64)
I have read lots of work by scientists pros and cons on evolution. That is all I can go by. Maybe if I meet the creator one day I'll know for sure.
 stargazer1000
Joined: 1/16/2008
Msg: 1241
Evolution.
Posted: 8/21/2011 10:40:44 AM

Maybe if I meet the creator one day I'll know for sure.


I strongly suspect you'll be waiting a LOOOOONG time!
 coca2
Joined: 4/8/2010
Msg: 1242
Evolution.
Posted: 8/21/2011 10:54:58 AM
We shall see. Ahhh ,evolution vs. religion or any other form of one's belief of creation never ceases to amaze me. I for one question all of it.
 stargazer1000
Joined: 1/16/2008
Msg: 1243
Evolution.
Posted: 8/21/2011 11:06:03 AM

Ahhh ,evolution vs. religion or any other form of one's belief of creation never ceases to amaze me.


And does one need to "believe" in chemistry? The laws of physics? The difference between science and religion is that science readily acknowledges when something is unknown and seeks the evidence to either prove or disprove its discoveries.

Religion sets up churches.


I for one question all of it.


Questioning is great! But I'm certainly not going to hold religious thought in the same regard as scientific discovery. Faith definitely ISN'T a virtue.
 coca2
Joined: 4/8/2010
Msg: 1244
Evolution.
Posted: 8/21/2011 11:31:27 AM
"science readily acknowledges when something is unknown and seeks the evidence to either prove or disprove its discoveries".....This is true. But at times science has "proven" something , only later to disprove it.
 Earthpuppy
Joined: 2/9/2008
Msg: 1246
view profile
History
Evolution.
Posted: 8/21/2011 2:15:48 PM
Krebby..not sure why the deletion occured..

There are many signs that evolution is ongoing. Not sure why an intelligent design would include a coccyx. Anyone who has broken one knows what a pain in the a...they can be.
http://listverse.com/2009/01/05/top-10-signs-of-evolution-in-modern-man/

http://www.lurj.org/article.php/vol4n1/genome.xml
http://news.nationalgeographic.com/news/2006/03/0308_060308_evolution.html
http://www.news-medical.net/news/2007/12/10/33341.aspx

We also see ongoing evolution all over the natural world. Not sure why people are so threatened by evolution. It would certainly help some people.
 stargazer1000
Joined: 1/16/2008
Msg: 1247
Evolution.
Posted: 8/21/2011 2:59:23 PM

This is true. But at times science has "proven" something , only later to disprove it.


True. Which is the self-correcting nature of the modern scientific method. It's one of its greatest strengths.

When was the last time you ever heard a creationist ever say "Oops, you know what!? We're wrong on that! Sorry. Our bad."
 aremeself
Joined: 12/31/2008
Msg: 1248
view profile
History
Evolution.
Posted: 8/21/2011 9:41:38 PM
[Curious that creationists will claim evolution is wrong because there's no proof of it, yet have absolutely no problem believing in the Biblical creation even though there's no proof of it. ]

many creationists have doubts, especially those who don't know how pathetic the evidence is to support any claims related to molecules to man, evolution.

after all, the pope, they say, supports evolution.
I'm sure he is studing it as we speak!

of course its way above a laymans head.
 aremeself
Joined: 12/31/2008
Msg: 1249
view profile
History
Evolution.
Posted: 8/21/2011 11:00:22 PM
there is too much to study completly, but as to the age of the earth and such, there seems to me to be some testing procedures that are automatically eliminated because they don't fit the preconceived ideas about how old things are.

eg. "we don't test dinosaur fossels the carbon way because they are 100 million or so years old."

apparently when carbon [which aparently is also not always reliable at younger ages]tested they date severel thousand years old, go figure.
 lyingcheat
Joined: 9/13/2009
Msg: 1250
view profile
History
Evolution.
Posted: 8/21/2011 11:32:09 PM

there is too much to study completly, but as to the age of the earth and such, there seems to me to be some testing procedures that are automatically eliminated because they don't fit the preconceived ideas about how old things are.

eg. "we don't test dinosaur fossels the carbon way because they are 100 million or so years old."

Carbon dating isn't "eliminated" from some testing procedures because of unfair or unreasonable preconceptions about age, and that isn't the reason carbon dating isn't used to test "dinosaur fossils".
Educate yourself.
http://lonewolfsden.net/2010/01/10/stupid-creationist-arguments-23-carbon-dating-is-unreliable/

apparently when carbon [which aparently is also not always reliable at younger ages]tested they date severel thousand years old, go figure.

Apparently? pfft!
You might be interested in some facts?
http://www.evolutionfaq.com/faq/isnt-carbon-dating-unreliable
http://en.wikipedia.org/wiki/Carbon_dating
Even some from the other side...
http://www.answersincreation.org/argument/G121_creation_science.htm
 aremeself
Joined: 12/31/2008
Msg: 1251
view profile
History
Evolution.
Posted: 8/22/2011 12:05:48 AM
there are apparently dinosaur bones that are not minralized and carbon date very young.

ok, I made that up, not.

who to believe, huh?
 lyingcheat
Joined: 9/13/2009
Msg: 1252
view profile
History
Evolution.
Posted: 8/22/2011 2:10:01 AM

As others linger on to old science, newer science progresses. each and every day. Thank you, there, lyingcheat. (what a login name, but I won't comment on it).

Cheers.
As for the pseudonym, it's my real name. Truly! My first name is Goddamn.


there are apparently dinosaur bones that are not minralized and carbon date very young.
ok, I made that up, not.

Assuming you didn't 'make it up', I'm surprised you didn't take the opportunity to post a link to reports of the finding.
But now's your chance -

It'll be most interesting to see your link, assuming it's forthcoming, because I must admit I'm wondering why any scientist, if the bones were "apparently" dinosaur bones would bother with carbon dating at all, given the factual information I provided about carbon dating in my previous post regarding the limitations of that method.
And one wonders also what alternative dating method they used next, given the surprise finding of "very young" dinosaur bones, and considering they'd just used a method that is known to be of no value on samples that are millions of years old.

I do hope you're not going to say 'they' didn't bother testing them any other way, and just accepted they'd found some young dinosaur bones, and nor did 'they' bother publishing this startling finding anywhere so people could read it. Because that would cast serious doubt as to your veracity. If nothing else.


who to believe, huh?

"Who" has nothing to do with it. 'What' is the important thing.
As in - verifiable facts or vague anecdote.
As in - published information open to scrutiny vs alleged hearsay of unknown origin.

Which of these categories does your 'young dinosaur bones' story fit into? Post the link and we'll see.
 abelian
Joined: 1/12/2008
Msg: 1253
Evolution.
Posted: 8/22/2011 9:21:20 AM

But at times science has "proven" something , only later to disprove it.

That isn't true, mainly because science makes no attempt to prove theories true. Science can only disprove theories or leave their status as supported by the existing evidence. To try to do otherwise would be fallacious logic.
 Earthpuppy
Joined: 2/9/2008
Msg: 1254
view profile
History
Evolution.
Posted: 8/22/2011 11:15:21 AM
Time out for some quite interesting findings and hypothesis' . Tea pickers and hail storms, 10,000 microbes per cubic meter miles above our heads, intergalactic microbes?..
Remembering back on hang gliding days, clouds of bugs sucked up in thermals smacking us in the face at cloudbase, wires full of spider strands, and rain later in the day.
http://e360.yale.edu/feature/the_long_strange_journey_of_earths_traveling_microbes/2436/

just a snip..


“Bioprecipitation” is a hot topic. And the more so as we learn how much biological matter there is in the atmosphere — more than 10,000 individual bacteria per cubic meter of air over the land, according to a 2009 study by Susannah Burrows of the Max Planck Institute for Chemistry in Mainz, Germany. These bacteria spend an average of about a week in the atmosphere; but while some stay close to the ground, others soar into the stratosphere, says Smith. Weather balloons have even found them in the mesosphere, up to 77 kilometers aloft, according to a forgotten study by Soviet scientist A. A. Imshenetsky, published in Applied and Environmental Biology as long ago as 1978 and uncovered by Smith.

This, says Dale Griffin of the U.S. Geological Survey in Tallahassee, Florida raises another interesting possibility. “Does the Earth shed microbial life into space, and how would this impact on our quest for extraterrestrial life? There are all kinds of interesting questions in this field, and very few people dabbling in it.”

Discovering how long they stay up is difficult. But a study after the eruption of Mount Pinatubo in 1991 found micron-size particles — a reasonable
We are constantly being rained on by bio-detritus from around the world, from dandruff and algae to pollen and fungi.
proxy for bacteria — still falling to Earth five years later. Certainly, the dispersal is global.

Is there a permanent stratospheric ecosystem with bacteria, fungal spores, and viruses spending their entire lives in the clouds and reproducing? “I think we can talk about an atmospheric ecosystem,” says Griffin. “It is of course more fluid than what we classically call an ecosystem, but there is life, and it is plentiful.”

Other parts of the planet once thought devoid of life — such as Antarctic ice, deep oceans and deep rock formations — turn out to contain living organisms. “So,” asks Griffin, “why not the stratosphere?”

We are constantly being rained on by bio-detritus from around the world — from dandruff and algae to pollen and fungi, bacteria, and viruses. Ruprecht Jaenicke of the Institute of Atmospheric Physics at the University of Mainz in Germany analyzed air samples from remote regions. He concluded in Science in 2005 that as much as a quarter of the aerosols in the atmosphere are of biological rather than geological origin.
 scorpiomover
Joined: 4/19/2007
Msg: 1255
view profile
History
Evolution.
Posted: 8/22/2011 1:58:08 PM

There are true facts in science. They are verifiable observations.
Yes, but if I, or anyone else, makes observations, then the thing that I was examining, at the time when I was examining it, had that observation true about it. But tomorrow, it might not be. For instance, today, you might see a caterpillar sitting on a leaf, and tomorrow, you might see it inside a chrysalis.
Today, you might see a chrysalis, and tomorrow, all you see is a broken cocoon and a butterfly far off into the distance.
Today, you might see a lion eat a gazelle. Tomorrow, the lion might be killed by another lion, or another animal.

Thus, the only observations that are facts, that I have access to, or anyone has access to, are those observations about the past, possibly about the present, but not about the future.

I can observe that because I saw a caterpillar on a leaf a month ago, and for the past 30 days, that same caterpillar has been there, on a leaf on that hedge, munching away. On that basis, I can conclude that it will continue to be there, for a long time into the future. But that is an inductive inference. It will be wrong, because the caterpillar will change into the butterfly. But until I see that happen, I remain blissfully ignorant.

What we observe about the past, even the present, that we believe will continue to happen into the future, are inductive inferences, and many of them are wrong. We are just too blissful to realise that yet.
 Earthpuppy
Joined: 2/9/2008
Msg: 1256
view profile
History
Evolution.
Posted: 8/22/2011 4:02:50 PM
By the same token, new religions are born, and new religious concepts are born frequently, from the Flying Spaghetti Monster, the young earth, Mormonism, the concept of the end times, Jim Jones, Terry Jones, etc.

At the same time, 30 years from now it's pretty obvious that sky-diving without a parachute will still turn out the same as it does today, as will staying underwater for more than 10 minutes, the ability to walk on water barefoot, sticking your head into a jet engine, walking into a fire, or spacewalking without a breathing apparatus, or having faith that cyanide will turn into wine after drinking it, should remain pretty constant in results, given observable science. Over vast stretches of time however...who knows.
 IgorFrankensteen
Joined: 6/29/2009
Msg: 1257
view profile
History
Evolution.
Posted: 8/24/2011 5:08:32 AM
Believers might change their INTERPRETATION of their sacred texts, but that's not the same thing as being willing to CHANGE THE TEXTS to actually fit the facts. That's the point of the post you responded to, and you didn't refute it with this post.

I would go further, and point out that most religious interpretation struggles are not remotely permanent, BECAUSE the basic texts are retained. The fact that we are seeing yet another resurgence of Christian "fundamentalism" in the U.S. even now, is a testimony to that.

If religions WERE updated, instead their followers simply pretending that "that
's what it REALLY meant all along," then your argument would have substantial backing. They aren't. It doesn't.
 inthroughtheoutdoor
Joined: 1/1/2011
Msg: 1258
Evolution.
Posted: 8/24/2011 9:08:53 PM

Scientists are coming up with new ideas all the time. But they're not thinking about how to at least TRY to make it compatible with religious folk's views. So they're either incompetent at thinking, or they are lazy at thinking. So they're either incompetent at thinking, or they are lazy at thinking. Either way, it's not an excuse for scientists to blame someone else for the problems they created.
**************************************************************************
So, let me see if I'm reading this correctly.

Science is supposed to make all investigatory processes, data, and findings "meaningful" in a religious sense? And if they don't do that, they're lazy or incompetent?


Hahaha. I find it funny that of the whole post, that is the one passage I wanted to comment on because as soon as I read it I immediately had this mental image of a scientist bent down over a desk while carefully sanding down the edges of the proverbial square peg not so much to make it fit but to at least be able to jam it in the round hole so that he could go THERE...ya see? It fits!

You know, I would never have believed without seeing with my own eyes some of the things I have read in here over the years but this even my eyes have trouble believing ... it's funny in a sad kind of way but I find it more disturbing than anything else because this is the type of thinking that leads to... bah I've said enough. It's gettin' late. Time for me to go rest my weary non existent soul. Bonne nuit everyone!
 abelian
Joined: 1/12/2008
Msg: 1259
Evolution.
Posted: 8/25/2011 8:24:09 AM

This thread is about evolution and it's posted in the science forums, so posts which are on topic in this thread should say something pertinent to evolution as it is relates to science. In particular, religious views on evolution belong in the religion forum and ``WTF is this all about'' comments should be posted in /dev/null (google this if you aren't a unix user). If your posts are deleted, it will be because I couldn't see how the post was relevant no matter how far I stretched my imagination to find some relevance. Thank you.
 FrogO_Oeyes
Joined: 8/21/2005
Msg: 1260
view profile
History
Evolution.
Posted: 8/28/2011 10:59:03 PM
If youth are confused, it's because their heads are crammed with unsubstantiated dogma, while concurrently being deprived of critical thinking skills or an ability to spell.

I'll spell it out again for BOTH sides of this debate who are unclear:
The Theory of Evolution does NOT REQUIRE EVIDENCE. It is a theory. Theories are substantiated hypotheses, and hypotheses are proposed explanations for observed facts. The theory of evolution does NOT propose that evolution occurs. It provides an explanation of why and how the FACT of evolution occurs. The theory did not magically appear from no-where - it was proposed as an explanation for the observation that evolution occurs.

To be slightly more blunt, since the evidence came before the theory, it is utter nonsense to seek such evidence afterwards. At best, one should seek contradictory evidence. In nearly two centuries, no-one has achieved that.

Y is it that people are more willing to believed we evolved from little bacteria or the Big Bang than God?

There is profuse evidence in support of the former. None at all for the latter, not even for a mechanism, or a definition of how to identify that mechanism.

I refused to believe in such things

This is by definition "willfull ignorance". Deny facts and chains of logic, while steadfastly clinging to alternatives which exclude facts and defy logic.

on other matters...
"Recombination" - is the...wait for it...recombination of genetic material. This process takes place in sexual reproduction. It involves highly similar chains of genetic material [DNA] pairing up and duplicating before dividing into identical cells. While paired, maternal and paternal DNA may swap matching pieces, resulting in single chains which include maternal versions of one gene and paternal versions of another. In un-recombined DNA, maternal and paternal variants are on separate strands. Recombination mixes existing variants on separate DNA strands, into single strands, and it's something of a mirror-image process.

The processes I have refered to previously are NOT recombination.

Maternal:
AQWRSTYGZ
AQWRSTYGZ

Paternal:
AqwRSTygZ
AqwRSTygZ

Paired:
AQWRSTYGZ
AqwRSTygZ

Recombined pair:
AqWRSTYgZ
AQwRSTyGZ

Recombinant offspring:
AqWRSTYgZ
AqWRSTYgZ

AQwRSTyGZ
AQwRSTyGZ

The offspring have all the same genes as the parents, but in a mix of versions which is not identical to either parent.

Examples above use symbols representing alleles [alternate versions] of entire genes which may be composed of thousands of bases.
Examples below use symbols representing the four bases of which DNA is composed: Adenosine, Guanine, Cytosine, and Thymine [AGCT].

"Duplication" mutations occur when a segment of DNA is copied back into the original strand. This increases the amount of DNA, has the effect of increasing activity of the gene in question, and because of these facts it leads to increased chances of other mutations [that is, additional mutations of a second copy will have no effect on proper function of other copies].

Original strand:
AGCCATCCGAGTATT

doubly-duplicated strand:
AGCCATCCGCATCCGCATCCGAGTATT

Such duplication may affect very small areas, or enormous regions containing thousands of bases.

"Non-dissociation" errors are failures of chromosomes to separate during cell division. This causes one cell to lose one or more [all] entire chromosomes, while the complimentary cell gains the second member of one or more [all] pairs. Some verions of this are refered to as polyploidy, because they involve the complete multiplication ["poly"] of all genetic material ["ploidy"]. Like duplication, this creates a lot of extra material for additional mutations to affect.

"Insertion" mutations are random errors which cause one or more extra bases to be inserted into the DNA. Seemingly trivial, this can have drastic effects, because it creates a 'counting error'. Since bases encode to tRNA in trios, all trios after the insertion are pushed one base out of sequence, completely cha nging how they are interpreted. To some degree, this is counteracted by the fact that DNA functions in paired strands. This pairing can cause the majority of matching bases to link up, while causing the inserted section to form an unpaired loop. Other correcting factors may also apply, such as later deletions or long sequences which signal an end of encoding regardless. The insertion still has an effect on how the DNA is translated, and it can still be inherited. When inherited, the effects may be more drastic, since the new paired DNA will match perfectly to it, and 'correction' factors may no longer apply.

"Deletion" mutations are the reverse of insertions, but because they also create counting errors, they can have very similar effects, consequences, and corrections.

These counting errors are called "frameshift" mutations.

Original:
AGCCATCCGCATCCGAGTATT

Insertion:
AGCCATCCGCGATCCGAGTATT

Deletion:
AGCCATCCG/CATCCGAGTATT

"Inversion" mutations are 'flips' in which a section of DNA is assembled in reverse or cut, flipped, and re-attached. Because it doesn't change the number of bases, it doesn't create a counting error. However, because DNA is translated only in a single direction, it can completely change the protein encoded by a particular segment.

"Substitution" mutations cause one base to be replaced with a different one.

Original:
AGCCATCCGCATCCGAGTATT

Inversion:
AGTACCCCGCATCCGAGTATT

Because everything is read in triplets, the coding changes from:
AGC-CAT-CCG [which encodes Serine-Histidine-Proline]
to:
AGT-ACC-CCG [which encodes Serine-Threonine-Proline]

Previous:
AGTACCCCGCATCCGAGTATT

Substitution:
AGAACCCCGCATCCGAGTATT
AGA-ACC-CCG [which encodes Arginine-Threonine-Proline]

Just for fun, lets do an addition on the last one...
TAGAACCCCGCATCCGAGTATT
TAG-AAC-CCC, which encodes "stop"-Asparagine-Proline. Only "stop" matters, causing this particular protein to be literally "cut off" at that point.

There are many more types of mutations, composed of specific versions of the above, and of chromosomal mutations which affect much larger blocks of DNA and how and when those blocks are read.

The real point is that mutation is NOT "recombination" of existing DNA, and in many cases it absolutely IS "new information". That new information isn't important because it encodes something new and spectacular. It's important because it is available to continue mutating. In some cases, it also has the result of duplicating a structure or process to benefit. Both cases are well-demonstrated at fundamental levels, with multiple copies of certain genes being the prime cause of body segmentation [centipede legs, human ribs and spine, etc], and mutations of some of those copies being responsible for new organs [insect antennae and mouthparts [legs], vertebrate jaws [gill arches], vertebrate earbones [jaw bones].
 stargazer1000
Joined: 1/16/2008
Msg: 1261
Evolution.
Posted: 8/29/2011 6:59:26 AM
FrogO...every part of that post was AWESOME!
 IgorFrankensteen
Joined: 6/29/2009
Msg: 1262
view profile
History
Evolution.
Posted: 9/4/2011 7:56:29 AM
Krebby: your post quoting a report about the Neanderthals is, as usual, interesting, but I don't know what your point in posting it is. I find all knowledge, and alleged knowledge to be fascinating, but I would be interested to know why you put it up.

As for the report itself, I don't have the education to completely understand what they are saying. What I DON'T see them saying, or it would have been trumpeted loudly across the planet, is that there is more than ONE ultimate "race" from which we are all descended. It sounds more like that they are just changing the map of interweaving branches and roots of our family tree, changing WHEN or IF one branch recrossed into the mainstream.

It's sort of like saying that though we USED to think that weird great-great-uncle Clyde had no descendants, that we have now found out he "messed around" with great-great-aunt Mathilde (who never let her husband know), and so we now realize why cousin Fred is so silly when he's drunk.

Is that it, or was there something else you wanted to show with this?
 cupper3
Joined: 8/28/2006
Msg: 1263
view profile
History
Evolution.
Posted: 9/4/2011 10:52:36 AM
Best line I have heard:

Religion can't explain science, and science can't explain religion.
 IgorFrankensteen
Joined: 6/29/2009
Msg: 1264
view profile
History
Evolution.
Posted: 9/4/2011 1:37:14 PM
One of the important things about evolution that I keep coming back to, is that it is a VERY sloppy business. Many of the people who get upset against it for any reason (other than politics), is that they seem to expect something SCIENTIFIC to be NEAT AND ORDERED. No doubt why Psychology still has so many doubters who claim it shouldn't be called a science at all.

Lots of people recognize that evolution brings CHANGE, but they mistakenly think that all evolutionary change is equivalent to PROGRESS. This talk about the "bushiness" of it all is a slight nod in the direction that I would very much wish more people could be made to understand, which is that one of the reasons evolutionary change is NATURALLY hard to grasp, IS that it's such a messy, chancy business.
 Earthpuppy
Joined: 2/9/2008
Msg: 1265
view profile
History
Evolution.
Posted: 9/4/2011 2:11:53 PM
MRSAs are an example of trying to keep up with rapid evolution of common bugs responding to attempts to control them.
http://evolution.berkeley.edu/evolibrary/news/080401_mrsa

Monsantos Roundup Ready crops and ensuing herbicide intensity have created superweeds and now superbugs in a negative feedback loop necessitating yet more herbicides.
http://www.grist.org/article/first-came-superweeds-and-now-come-the-superbugs

The anti-biotic "revolution" has only been around for around 70 years, about 3-4 generations of humans, but thousands of generations of the bugs we sought to combat. We are reaching the limits of keeping up to that aspect of evolution.
Show ALL Forums  > Science/philosophy  >